Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
LDV-C

PKB-number: PKB217
Definition: ORF1a/ORF1b (polymerase) ribosomal frameshift site
Organism: lactate dehydrogenase-elevating virus, strain C
Abbreviation: LDV-C
RNA type: Viral Frameshift
Keywords: arterivirus; ribosomal frameshifting; polymerase
EMBL number: L13298
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Godeny E.K. et al. (1993). Virology 194:585-596.
Stem sizes:
Loop sizes:
11 6
3 3 19
Position Paired:
6843-6853; 6866-6876
6857-6862; 6896-6901
Bracket view of structure:
          6830      6840      6850      6860      6870      6880
      #      |123456789|123456789|123456789|123456789|123456789|123456789
      $ 6830 UUUAAACUGCUAGCCACCUCUGGUCUCGACCGCUGUACUAGAGGUGGGCUGACGGUGUYU=6889
      % 6830 :::::::::::::(((((((((((:::[[[[[[:::))))))))))):::::::::::::
          6890      6900
      #      |123456789|12
      $ 6890 GGCGAUGCGGUCA=6902
      % 6890 ::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-22 PKB00233.html