Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
DCV_IRES-PKII

PKB-number: PKB219
Definition: Pseudoknot PKII of the internal ribosomal entry site (IRES) region
Organism: Drosophila C virus
Abbreviation: DCV_IRES-PKII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF014388
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
18 6
10 8 67
Position Paired:
6078-6086; 6139-6147
6093-6101; 6126-6134
6112-6117; 6215-6220
Bracket view of structure:
             6080      6090      6100      6110      6120
      #      789|123456789|123456789|123456789|123456789|1234
      $ 6077 AGUUAAGAUGUGAUCUUGCUUCCUUAUACAAUUUUGAGAGGUUAAUAA=6124
      % 6077 :(((((((((::::::(((((((((::::::::::[[[[[[:::::::
               6130      6140
      #      56789|123456789|12345678 (64)
      $ 6125 GAAGGAAGUAGUGCUAUCUUAAUA=6148
      % 6125 :)))))))))::::))))))))):
                 6220
      # (64) 3456789|123
      $ 6213 ACCCUCUCUGC=6223
      % 6213 ::]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00219.html