Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
DCV_IRES-PKIII

PKB-number: PKB220
Definition: Pseudoknot PKIII of the internal ribosomal entry site (IRES) region
Organism: Drosophila C virus
Abbreviation: DCV_IRES-PKIII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF014388
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
4 9
19 0 15
Position Paired:
6151-6154; 6184-6187
6157-6160; 6165-6168
6174-6177; 6209-6212
6179-6183; 6203-6207
6189-6191; 6197-6199
Bracket view of structure:
          6150      6160      6170      6180      6190      6200      6210
      #      |123456789|123456789|123456789|123456789|123456789|123456789|123
      $ 6150 UUAGGUUAACUAUUUAGUUUUACUGUUCAGGAUGCCUAUUGGCAGCCCCAUAAUAUCCAGGACA=6213
      % 6150 :((((::((((::::)))):::::[[[[:[[[[[)))):(((:::::))):::]]]]]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00220.html