Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CrPV_IRES-PKII

PKB-number: PKB222
Definition: Pseudoknot PKII of the internal ribosomal entry site (IRES) region
Organism: Cricket paralysis virus
Abbreviation: CrPV_IRES-PKII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF218039
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
17 6
10 8 68
Position Paired:
6029-6036; 6089-6096
6043-6051; 6076-6084
6062-6067; 6165-6170
Bracket view of structure:
            6030      6040      6050      6060      6070      6080      6090
      #      89|123456789|123456789|123456789|123456789|123456789|123456789|1234567 (66)
      $ 6028 GCAAAAAUGUGAUCUUGCUUGUAAAUACAAUUUUGAGAGGUUAAUAAAUUACAAGUAGUGCUAUUUUUGU=6097
      % 6028 :((((((((::::::(((((((((::::::::::[[[[[[::::::::)))))))))::::)))))))):
                6170
      # (66) 456789|123
      $ 6164 CCCUCUCUGC=6173
      % 6164 :]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00222.html