Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CrPV_IRES-PKIII

PKB-number: PKB223
Definition: Pseudoknot PKIII of the internal ribosomal entry site (IRES) region
Organism: Cricket paralysis virus
Abbreviation: CrPV_IRES-PKIII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF218039
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
4 9
19 0 15
Position Paired:
6101-6104; 6134-6137
6107-6110; 6115-6118
6124-6127; 6159-6162
6129-6133; 6153-6157
6138-6141; 6147-6150
Bracket view of structure:
          6100      6110      6120      6130      6140      6150      6160
      #      |123456789|123456789|123456789|123456789|123456789|123456789|123
      $ 6100 UUAGGUUAGCUAUUUAGCUUUACGUUCCAGGAUGCCUAGUGGCAGCCCCACAAUAUCCAGGAAG=6163
      % 6100 :((((::((((::::)))):::::[[[[:[[[[[))))((((:::::))))::]]]]]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00223.html