Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TrV_IRES-PKII

PKB-number: PKB225
Definition: Pseudoknot PKII of the internal ribosomal entry site (IRES) region
Organism: Triatoma virus
Abbreviation: TrV_IRES-PKII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF178440
Submitted by: A.P.Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
17 7
9 8 68
Position Paired:
5925-5933; 5984-5992
5940-5947; 5972-5979
5957-5963; 6061-6067
Bracket view of structure:
                5930      5940      5950      5960      5970      5980      5990
      #      456789|123456789|123456789|123456789|123456789|123456789|123456789|123(66)
      $ 5924 CUUGACUAUGUGAUCUUGCUUUCGUAAUAAAAUUCUGUACAUAAAAGUCGAAAGUAUUGCUAUAGUUAAG=5993
      % 5924 :(((((((((::::::((((((((:::::::::[[[[[[[::::::::))))))))::::))))))))):
          6060      6070
      # (66) |123456789|
      $ 6060 UGUACAGAAUU=6070
      % 6060 :]]]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00225.html