Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TrV_IRES-PKIII

PKB-number: PKB226
Definition: Pseudoknot PKIII of the internal ribosomal entry site (IRES) region
Organism: Triatoma virus
Abbreviation: TrV_IRES-PKIII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF178440
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
4 8
19 1 16
Position Paired:
5997-6000; 6030-6033
6003-6006; 6011-6014
6020-6023; 6055-6058
6025-6028; 6050-6053
6034-6037; 6043-6046
Bracket view of structure:
              6000      6010      6020      6030      6040      6050
      #      6789|123456789|123456789|123456789|123456789|123456789|123456789
      $ 5996 UGCGCUUGCCUAUUUAGGCAUACUUCUCAGGAUGGCGCGUUGCAGUCCAACAAGAUCCAGGGAC=6059
      % 5996 :((((::((((::::)))):::::[[[[:[[[[:))))((((:::::)))):::]]]]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00226.html