Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BQCV_IRES-PKI

PKB-number: PKB227
Definition: Pseudoknot PKI of the internal ribosomal entry site (IRES) region
Organism: Black queen cell virus
Abbreviation: BQCV_IRES-PKI
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF183905
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
9 5
1 0 8
Position Paired:
5795-5799; 5819-5823
5803-5806; 5813-5816
5808-5812; 5832-5836
Bracket view of structure:
                5800      5810      5820      5830
      #      456789|123456789|123456789|123456789|1234567
      $ 5794 AUGUUUAGAAGAUUAGGUAGUCUCUAAACAGAACAAUUUACCUG=5837
      % 5794 :(((((:::((((:[[[[[))))::)))))::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00227.html