Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BQCV_IRES-PKII

PKB-number: PKB228
Definition: Pseudoknot PKII of the internal ribosomal entry site (IRES) region
Organism: Black queen cell virus
Abbreviation: BQCV_IRES-PKII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF183905
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
19 7
10 6 68
Position Paired:
5647-5655; 5709-5717
5662-5671; 5695-5704
5682-5688; 5786-5792
Bracket view of structure:
              5650      5660      5670      5680      5690      5700      5710
      #      6789|123456789|123456789|123456789|123456789|123456789|123456789|12345678 (66)
      $ 5646 ACCAACAAUGUGAUCUUGCUUGCGGAGGCAAAAUUUGCACAGUAUAAAAUCUGCAAGUAGUGCUAUUGUUGGA=5718
      % 5646 :(((((((((::::::((((((((((::::::::::[[[[[[[::::::))))))))))::::))))))))):
               5790
      # (66) 56789|123
      $ 5785 AACUGUGCU=5793
      % 5785 :]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00228.html