Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
RhPV_IRES-PKI

PKB-number: PKB230
Definition: Pseudoknot PKI of the internal ribosomal entry site (IRES) region
Organism: Rhopalosiphum padi virus
Abbreviation: RhPV_IRES-PKI
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF022937
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
12 5
1 0 7
Position Paired:
7064-7067; 7094-7097
7069-7070; 7091-7092
7071-7072; 7088-7089
7074-7077; 7084-7087
7079-7083; 7105-7109
Bracket view of structure:
                 7070      7080      7090      7100      7110
      #      3456789|123456789|123456789|123456789|123456789|
      $ 7063 CAGGAGAGCAUACGCUAGGUCGCGUUGACUAUCCUUAUAUAUGACCUG=7110
      % 7063 :((((:((((:((((:[[[[[)))))):)):)))):::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00230.html