Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
RhPV_IRES-PKII

PKB-number: PKB231
Definition: Pseudoknot PKII of the internal ribosomal entry site (IRES) region
Organism: Rhopalosiphum padi virus
Abbreviation: RhPV_IRES-PKII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF022937
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
17 5
6 7 61
Position Paired:
6935-6943; 6988-6996
6950-6957; 6976-6983
6964-6968; 7058-7062
Bracket view of structure:
                6940      6950      6960      6970      6980      6990
      #      456789|123456789|123456789|123456789|123456789|123456789|1234567 (59)
      $ 6934 UAGUGUUGUGUGAUCUUGCGCGAUAAAUGCUGACGUGAAAACGUUGCGUAUUGCUACAACACUU=6997
      % 6934 :(((((((((::::::((((((((::::::[[[[[:::::::))))))))::::))))))))):
             7060
      # (59) 789|123
      $ 7057 ACGUCAC=7063
      % 7057 :]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00231.html