Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
RhPV_IRES-PKIII

PKB-number: PKB232
Definition: Pseudoknot PKIII of the internal ribosomal entry site (IRES) region
Organism: Rhopalosiphum padi virus
Abbreviation: RhPV_IRES-PKIII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF022937
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
3 7
20 1 17
Position Paired:
6997-6999; 7029-7031
7002-7005; 7010-7013
7020-7022; 7054-7056
7024-7027; 7049-7052
7034-7036; 7042-7044
Bracket view of structure:
              7000      7010      7020      7030      7040      7050
      #      6789|123456789|123456789|123456789|123456789|123456789|1234567
      $ 6996 UUGGUUAGCUAUUUAGCUUUACUAAUCAAGACGCCGUCGUGCAGCCCACAAAAGUCUAGAUA=7057
      % 6996 :(((::((((::::))))::::::[[[:[[[[:)))::(((:::::)))::::]]]]:]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00232.html