Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Vp_PK2

PKB-number: PKB234
Definition: Pseudoknot PK2 of Variovorax paradoxus tmRNA
Organism: Variovorax paradoxus
Abbreviation: Vp_PK2
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA; beta-proteobacteria
EMBL number:
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison; 3D-modeling
References: [1] Felden B., Massire C., Westhof E., Atkins J.F. & Gesteland R.F. (2001). Nucleic Acids Res. 29:1602-1607.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmRNA).
[3] Knudsen B., Wower J., Zwieb C., & Gorodkin J. (2001). Nucleic Acids Res. 29:171-172. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/).
Comment: This type of the PK2 pseudoknot structure is conserved in tmRNAs from the beta-proteobacteria [1].
Stem sizes:
Loop sizes:
9 7
3 2 7
Position Paired:
136-141; 198-203
144-146; 159-161
150-156; 211-217
163-177; 182-196
Bracket view of structure:
               140       150       160       170       180       190       200
      #     56789|123456789|123456789|123456789|123456789|123456789|123456789|1234
      $ 135 GCCUUGCAACAGUUGGCCGAUGGGCUGGGCAAGGGGGUCUGGAGCAAUCCUGACCUCCCGGCUGCAAGGA=204
      % 135 :((((((::(((:::[[[[[[[::))):(((((((((((((((::::))))))))))))))):)))))):
               210
      #     56789|12345678
      $ 205 UAACUACAUGGGCU=218
      % 205 ::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-22 PKB00234.html