Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
GLV_IRES

PKB-number: PKB235
Definition: Pseudoknot in the putative downstream IRES of Giardiaviral transcript
Organism: Giardiavirus
Abbreviation: GLV_IRES
RNA type: Viral others
Keywords: Giardiavirus; Capsid coding region; IRES
EMBL number: L13218
Submitted by: Srinivas Garlapati and Ching C. Wang ( srini@itsa.ucsf.edu)
Supported by: Mutagenesis; Structure probing
References: [1] Garlapati S. & Wang C.C. (2002). RNA 8:601-611.
Comment:
Stem sizes:
Loop sizes:
6 5
4 0 51
Position Paired:
144-149; 159-164
154-158; 216-220
166-170; 178-182
193-199; 209-215
Bracket view of structure:
                150       160       170       180       190       200
      #     456789|123456789|123456789|123456789|123456789|123456789|
      $ 144 GGAGACCCAUGGAGAGUCUCCAGAGGUUCCUAAGGCCUCGAUCGCGCCUGCCGGGAG=200
      % 144 ((((((::::[[[[[)))))):(((((:::::::)))))::::::::::(((((((:
                   210       220
      #     123456789|123456789|
      $ 201 GCAGAAUGUCCCGGUUCUCC=220
      % 201 ::::::::)))))))]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00235.html