Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IFNG_PK

PKB-number: PKB236
Definition: regulatory pseudoknot of the interferon-gamma gene 5'-UTR
Organism: Homo sapiens
Abbreviation: IFNG_PK
RNA type: mRNA
Keywords: translation; PKR
EMBL number: J00219
Submitted by: Raymond Kaempfer ( kaempfer@huji.ac.il)
Supported by: Mutagenesis; Structure probing
References: [1] Ben-Asouli Y., Banai Y., Pel-Or Y., Shir A. & Kaempfer R. (2002). Cell 108:221-232.
Comment:
Stem sizes:
Loop sizes:
7 33
0 4 7
Position Paired:
8-14; 64-70
15-19; 116-120
20-22; 112-114
25-29; 103-107
32-36; 97-101
41-48; 86-93
51-53; 83-85
56-59; 78-81
Bracket view of structure:
                  10        20        30        40        50        60
      #   123456789|123456789|123456789|123456789|123456789|123456789|
      $ 1 CAUUGUUCUGAUCAUCUGAAGAUCAGCUAUUAGAAGAGAAAGAUCAGUUAAGUCCUUUGG=60
      % 1 :::::::((((((([[[[[[[[::[[[[[::[[[[[::::[[[[[[[[::[[[::[[[[:
                   70        80        90       100       110       120
      #    123456789|123456789|123456789|123456789|123456789|123456789|
      $ 61 ACCUGAUCAGCUUGAUACAAGAACUACUGAUUUCAACUUCUUUGGCUUAAUUCUCUCGGA=120
      % 61 :::))))))):::::::]]]]:]]]]]]]]]]]:::]]]]]:]]]]]::::]]]:]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00236.html