Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
WNV_PK3

PKB-number: PKB237
Definition: A 3'-terminal pseudoknot
Organism: West Nile virus
Abbreviation: WNV_PK3end
RNA type: Viral 3 UTR
Keywords: Flaviviridae; Japanese encephalitis virus group
EMBL number: M12294
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing; thermal melting
References: [1]Shi P.Y., Brinton M.A., Veal J.M., Zhong Y.Y. & Wilson W.D. (1996). Biochemistry 35:4222-4230.
[2] Proutski V., Gould E.A. & Holmes E.C. (1997). Nucleic Acids Res. 25:1194-1202.
Comment: Similar pseudoknots can be folded in other flaviviruses.
Stem sizes:
Loop sizes:
5 4
2 0 6
Position Paired:
10868-10872; 10879-10883
10875-10878; 10890-10893
10895-10897; 10949-10951
10898-10901; 10944-10947
10903-10911; 10934-10942
10913-10916; 10924-10927
Bracket view of structure:
             10870     10880     10890     10900     10910     10920
      #       789|123456789|123456789|123456789|123456789|123456789|
      $ 10867 ACCUGGGAUAGACUAGGGGAUCUUCUGCUCUGCACAACCAGCCACACGGCACAG=10920
      % 10867 :(((((::[[[[)))))::::::]]]]:(((((((:(((((((((:((((::::
                   10930     10940     10950     10960
      #       123456789|123456789|123456789|123456789|12
      $ 10921 UGCGCCGACAUAGGUGGCUGGUGGUGCUAGAACACAGGAUCU=10962
      % 10921 :::))))::::::))))))))):)))):))):::::::::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00237.html