Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
DEN2_PK1

PKB-number: PKB238
Definition: A pseudoknot in the 3'-UTR
Organism: Dengue virus type 2
Abbreviation: DEN2_PK1
RNA type: Viral 3 UTR
Keywords: Flaviviridae; Dengue virus
EMBL number: M29095
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison;
References: [1] Olsthoorn R.C.L. & Bol J.F. (2001). RNA 7:1370-1377.
Comment: A duplication of this pseudoknot is possible in the upstream region, with some nucleotide substitutions. Similar pseudoknots can be folded in other flaviviruses [1].
Stem sizes:
Loop sizes:
16 5
3 1 9
Position Paired:
10540-10545; 10602-10607
10546-10547; 10580-10581
10551-10558; 10568-10575
10588-10591; 10598-10601
10562-10566; 10617-10621
Bracket view of structure:
           10540     10550     10560     10570     10580     10590
      #       9|123456789|123456789|123456789|123456789|123456789|12345
      $ 10539 AUGGGGGCCCAAGGUGAGAUGAAGCUGUAGUCUCACUGGAAGGACUAGAGGUUAGAG=10595
      % 10539 :((((((((:::((((((((:::[[[[[:))))))))::::))::::::((((::::
              10600     10610     10620
      #       6789|123456789|123456789|12
      $ 10596 GAGACCCCCCCAAAACAAAAAACAGCA=10622
      % 10596 ::)))))))))):::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00238.html