Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HIV1_lrPK

PKB-number: PKB239
Definition: Long range pseudoknot in the HIV-1 5'-UTR
Organism: human immunodeficiency virus type 1 (Mal isolate)
Abbreviation: HIV1_lrPK
RNA type: Viral others
Keywords: retrovirus; long range pseudoknot
EMBL number: X04415
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] Paillart J.-C., Skripkin E., Ehresmann B., Ehresmann C., Marquet R. (2002). J. Biol. Chem. 277:5995-6004.
Comment:
Stem sizes:
Loop sizes:
11 7
4 0 358
Position Paired:
60-63; 95-98
66-67; 90-91
68-72; 84-88
77-83; 457-463
434-436; 454-456
439-444; 448-453
Bracket view of structure:
           60        70        80        90       100
      #    9|123456789|123456789|123456789|123456789| (332)
      $ 59 UGCUUAAGCCUCAAUAAAGCUUGCCUUGAGUGCCUCAAGCAG=100
      % 59 :((((::(((((((::::[[[[[[[))))):)):::))))::
                 440       450       460       470
      #(332)3456789|123456789|123456789|123456789|
      $ 433 AUAUAGACUGAAACAUUUAGUAUGGGCAAGCAGGGAGC=470
      % 433 :(((::((((((:::)))))))))]]]]]]]:::::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00239.html