Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
RBV_PKb

PKB-number: PKB242
Definition: 3'-UTR pseudoknot
Organism: Rio Bravo virus
Abbreviation: RBV_PKb
RNA type: Viral 3 UTR
Keywords: flavivirus; NKV (no known vector)
EMBL number: AF452049
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison;
References: [1] Charlier N. et al. (2002). J. Gen. Virol. 83:1875-1885.
Comment:
Stem sizes:
Loop sizes:
4 8
3 0 5
Position Paired:
151-154; 166-169
158-165; 175-182
Bracket view of structure:
          150       160       170       180
      #     |123456789|123456789|123456789|123
      $ 150 UGAGGUUUUUCCCCUCCCUCAUGAUGAGGGGAAG=183
      % 150 :((((:::[[[[[[[[)))):::::]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00242.html