Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
hTER

PKB-number: PKB243
Definition: human telomerase RNA pseudoknot
Organism: Homo sapiens
Abbreviation: hTER
RNA type: Others
Keywords: ribonucleoprotein; telomerase
EMBL number: AF221907
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Mutagenesis; NMR; Sequence comparison;
References: [1] Chen J.L. et al. (2000). Cell 100:503-514.
[2] Theimer C.A. et al. (2003). PNAS 100:449-454.
[3] Ly H. et al. (2003). Genes & Development 17:1078-1083.
Comment: The pseudoknot is conserved in the vertebrate telomerase RNAs [1]. The conformational transitions of this pseudoknot structure to the hairpin conformation [2] and to the dimeric \"trans-pseudoknot\" [3] have been proposed.
Stem sizes:
Loop sizes:
22 9
8 0 29
Position Paired:
65-67; 142-144
68-72; 136-140
78-82; 127-131
90-98; 116-124
107-112; 178-183
113-115; 174-176
Bracket view of structure:
                70        80        90       100       110       120
      #    456789|123456789|123456789|123456789|123456789|123456789|12345
      $ 64 GGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGG=125
      % 64 :((((((((:::::(((((:::::::(((((((((::::::::[[[[[[[[[))))))))):
              130       140       150       160       170       180
      #     6789|123456789|123456789|123456789|123456789|123456789|1234
      $ 126 AAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCU=184
      % 126 :)))))::::))))):))):::::::::::::::::::::::::::::]]]:]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00243.html