Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HAV

PKB-number: PKB244
Definition: HAV 3'end pseudoknot
Organism: hepatitis A virus
Abbreviation: HAV
RNA type: Viral 3 UTR
Keywords: RNA replication; protein binding
EMBL number: M16632
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Structure probing;
References: [1] Dollenmaier G. & Weitz M. (2003). J. Gen. Virol. 84:403-414.
Comment:
Stem sizes:
Loop sizes:
10 7
9 0 9
Position Paired:
7420-7429; 7446-7455
7439-7441; 7470-7472
7442-7445; 7465-7468
Bracket view of structure:
           7420      7430      7440      7450      7460      7470
      #      9|123456789|123456789|123456789|123456789|123456789|123
      $ 7419 UUAAACAAAUUUUCUUAAAAUUUCUGAGGUUUGUUUAUUUCUUUUAUCAGUAAAU=7473
      % 7419 :((((((((((:::::::::[[[[[[[)))))))))):::::::::]]]]:]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00244.html