Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HPeV1

PKB-number: PKB245
Definition: 5'-UTR pseudoknot
Organism: Human Parechovirus 1
Abbreviation: HPeV1
RNA type: Viral 5 UTR
Keywords: Picornaviridae; RNA replication
EMBL number: L02971
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Mutagenesis;
References: [1] Nateri A.S. et al. (2002). J. Virol. 76:13116-13122.
Comment:
Stem sizes:
Loop sizes:
6 5
2 0 9
Position Paired:
80-85; 93-98
88-92; 108-112
Bracket view of structure:
           80        90       100       110
      #    9|123456789|123456789|123456789|123
      $ 79 CCCAGCCUUGGGGUGGCUGGUCAAUAAAAACCCCC=113
      % 79 :((((((::[[[[[)))))):::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00245.html