Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HCV

PKB-number: PKB246
Definition: HCV IRES domain IV pseudoknot of unknown function
Organism: Hepatitis C Virus
Abbreviation: HCV
RNA type: Viral 5 UTR
Keywords: Flaviviridae; HCV; IRES-dependent translation
EMBL number: AJ238799
Submitted by: William B. Lott
Supported by: Mutagenesis; Sequence comparison; Structure probing;
References:
Comment: This is pseudoknot of unknown function that harbors the HCV start codon and utilizes sequences from both the HCV 5'UTR and the HCV ORF.
Stem sizes:
Loop sizes:
6 4
5 0 6
Position Paired:
331-332; 353-354
334-337; 347-350
343-346; 361-364
Bracket view of structure:
             340       350       360
#     123456789|123456789|123456789|1234
$ 331 GACCGTGCACCATGAGCACGAATCCTAAACCTCA=364
% 331 ((:((((:::::[[[[))))::))::::::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00246.html