Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NeRNV_PKa

PKB-number: PKB247
Definition: tRNA-like structure 3'end pseudoknot PKa of Nemesia ring necrosis virus
Organism: Nemesia ring necrosis virus
Abbreviation: NeRNV_PKa
RNA type: Viral tRNA-like
Keywords: Tymovirus; histidylation
EMBL number: AY751778
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison; histidylation
References: [1] Koenig R. et al. (2005). J. Gen. Virol. 86:1827-1833
Comment:
Stem sizes:
Loop sizes:
3 4
2 0 2
Position Paired:
6265-6267; 6274-6276
6270-6273; 6279-6282
Bracket view of structure:
          6270      6280
#      456789|123456789|12345
$ 6264 CCCCUGUCCCGGGUAGGGAACC=6285
% 6264 :(((::[[[[)))::]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00247.html