Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NeRNV_PKb

PKB-number: PKB248
Definition: tRNA-like structure pseudoknot PKb of Nemesia ring necrosis virus
Organism: Nemesia ring necrosis virus
Abbreviation: NeRNV_PKb
RNA type: Viral tRNA-like
Keywords: tymovirus; histidylation
EMBL number: AY751778
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison; histidylation
References: [1] Koenig R. et al. (2005). J. Gen. Virol. 86:1827-1833.
Comment:
Stem sizes:
Loop sizes:
6 3
5 32 8
Position Paired:
6186-6191; 6232-6237
6197-6199; 6246-6248
6200-6203; 6228-6231
6208-6214; 6220-6226
Bracket view of structure:
         6190      6200      6210      6220      6230      6240      6250
#      56789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 6185 UGUUCCUUGGAUUGCUACGUUCACCAGAUUUGUGUAAUCUGGCCGUUAGGAACUUAAAAUUGCGCG=6250
% 6185 :((((((:::::[[[((((::::(((((((:::::))))))):))))))))))::::::::]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00248.html