Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NeRNV_UPD-PK1

PKB-number: PKB249
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'UTR of Nemesia ring necrosis virus
Organism: Nemesia ring necrosis virus
Abbreviation: NeRNV_UPD-PK1
RNA type: Viral 3 UTR
Keywords: tymovirus
EMBL number: AY751778
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Koenig R. et al. (2005). J. Gen. Virol. 86:1827-1833.
Comment:
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
6134-6137; 6148-6151
6142-6146; 6160-6164
6147-6147; 6158-6158
Bracket view of structure:
           6140      6150      6160
#      3456789|123456789|123456789|12345
$ 6133 UAGUGUUUCGGCUUCCACUUAAAUCGAAAGCCA=6165
% 6133 :((((::::[[[[[[))))::::::]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00249.html