Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NeRNV_UPD-PK2

PKB-number: PKB250
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of Nemesia ring necrosis virus
Organism: Nemesia ring necrosis virus
Abbreviation: NeRNV_UPD-PK2
RNA type: Viral 3 UTR
Keywords: tymovirus
EMBL number: AY751778
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Koenig R. et al. (2005). J. Gen. Virol. 86:1827-1833.
Comment:
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6112-6114; 6122-6124
6116-6121; 6128-6133
Bracket view of structure:
             6120      6130
#      123456789|123456789|1234
$ 6111 GGGUGGCGCACACCACAGUGCGUA=6134
% 6111 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00250.html