Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NeRNV_UPD-PK3

PKB-number: PKB251
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'UTR of Nemesia ring necrosis virus
Organism: Nemesia ring necrosis virus
Abbreviation: NeRNV_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tymovirus
EMBL number: AY751778
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Koenig R. et al. (2005). J. Gen. Virol. 86:1827-1833.
Comment:
Stem sizes:
Loop sizes:
3 5
2 1 5
Position Paired:
6088-6090; 6099-6101
6093-6097; 6107-6111
Bracket view of structure:
       6090      6100      6110
#      789|123456789|123456789|12
$ 6087 CAGCCUCUCACAGCUUCCUCGUGAGG=6112
% 6087 :(((::[[[[[:))):::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00251.html