Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ribox02

PKB-number: PKB252
Definition: Alcohol dehydrogenase ribozyme
Organism:
Abbreviation: ribox02
RNA type: Ribozymes
Keywords: in vitro evolution
EMBL number:
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison;
References: Tsukiji S., Pattnaik S.B. & Suga H. (2003). Nature Struct. Biol. 10:713-717.
Comment:
Stem sizes:
Loop sizes:
6 9
31 5 28
Position Paired:
1-6; 52-57
8-12; 32-36
16-21; 26-31
63-69; 76-82
38-46; 86-94
96-101; 105-110
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGGAUCGUCAGUGCAUUGAGAUGUUUCUCAGACUGAUUAUCGUGAGACAGUGAUCUCGUG=60
% 1 ((((((:(((((:::((((((::::))))))))))):[[[[[[[[[:::::)))))):::

             70        80        90       100       110
#    123456789|123456789|123456789|123456789|123456789|
$ 61 GUCAGUCCUAGUUUGGGGGCUGGUCCUCACGGUGGUAUCCCCAAGGGGUA=110
% 61 ::(((((((::::::))))))):::]]]]]]]]]:((((((:::))))))

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00252.html