Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
WBV

PKB-number: PKB253
Definition: ORF1a/1b ribosomal frameshift site of White Bream Virus
Organism: White Bream Virus
Abbreviation: WBV
RNA type: Viral Frameshift
Keywords: Nidovirales; ribosomal frameshifting
EMBL number: NC_008516
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Schutze H. et al. (2006). J. Virol. 80:11598-11609.
Comment:
Stem sizes:
Loop sizes:
14 5
3 0 29
Position Paired:
14560-14573; 14582-14595
14577-14581; 14625-14629
Bracket view of structure:
     14550     14560     14570     14580     14590     14600
#       9|123456789|123456789|123456789|123456789|123456789|
$ 14549 UUUAAACUGGUGGGGCAGUGUCUAGGAUUGACGUUAGACACUGCUUUUUGCC=14600
% 14549 :::::::::::((((((((((((((:::[[[[[)))))))))))))):::::

             14610     14620     14630
#       123456789|123456789|123456789|
$ 14601 CGUUUCAAACAGGUGAAUACAAACCGUCAU=14630
% 14601 ::::::::::::::::::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00253.html