Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SARS-CoV

PKB-number: PKB254
Definition: ORF1a/1b ribosomal frameshift site of SARS coronavirus
Organism: SARS coronavirus
Abbreviation: SARS-CoV
RNA type: Viral Frameshift
Keywords: Coronaviridae; ribosomal frameshifting
EMBL number: NC_004718
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Thiel V. et al. (2003). J. Gen. Virol. 84:2305-2315.
[2] Dos Ramos F. et al. (2004). Biochem. Soc. Trans. 32:1081-1083.
Comment:
Stem sizes:
Loop sizes:
11 7
3 0 29
Position Paired:
13404-13414; 13425-13435
13418-13422; 13468-13472
13423-13424; 13465-13466
13436-13440; 13457-13461
13441-13443; 13453-13455
Bracket view of structure:
            13400     13410     13420     13430     13440
#       23456789|123456789|123456789|123456789|123456789|123456789
$ 13392 UUUAAACGGGUUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUA=13449
% 13392 ::::::::::::(((((((((((:::[[[[[[[)))))))))))((((((((::::::

    13450     13460     13470
#       |123456789|123456789|123
$ 13450 GUACUGAUGUCGUCUACAGGGCUU=13473
% 13450 :::))):))))):::]]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00254.html