Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
MHV

PKB-number: PKB255
Definition: 3'UTR pseudoknot of mouse hepatitis virus
Organism: mouse hepatitis virus
Abbreviation: MHV
RNA type: Viral 3 UTR
Keywords: Coronaviridae;
EMBL number: AY700211
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison;
References: [1] Goebel S.J. et al. (2004). J. Virol. 78:669-682.
Comment:
Stem sizes:
Loop sizes:
8 10
15 1 2
Position Paired:
31098-31105; 31132-31139
31121-31130; 31142-31151
Bracket view of structure:
       31100     31110     31120     31130     31140     31150
#       789|123456789|123456789|123456789|123456789|123456789|12
$ 31097 CUCUCUAUCAGAAUGGAUGUCUUGCUGUCAUAACAGAUAGAGAAGGUUGUGGCAGA=31152
% 31097 :((((((((:::::::::::::::[[[[[[[[[[:))))))))::]]]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00255.html