Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BCV

PKB-number: PKB256
Definition: 3'UTR pseudoknot of bovine coronavirus
Organism: bovine coronavirus
Abbreviation: BCV
RNA type: Viral 3 UTR
Keywords: Coronaviridae;
EMBL number: DQ811784
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing;
References: [1] Williams G.D. et al. (1999). J. Virol. 73:8349-8355.
Comment:
Stem sizes:
Loop sizes:
8 10
15 1 2
Position Paired:
30803-30810; 30837-30844
30826-30835; 30847-30856
Bracket view of structure:
            30810     30820     30830     30840     30850
#       23456789|123456789|123456789|123456789|123456789|1234567
$ 30802 CUCUCUAUCAGAAUGGAUGUCUUGCUGCUAUAAUAGAUAGAGAAGGUUAUAGCAGA=30857
% 30802 :((((((((:::::::::::::::[[[[[[[[[[:))))))))::]]]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00256.html