Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PYVV1

PKB-number: PKB259
Definition: A 3'-terminal pseudoknot in PYVV RNA 1
Organism: potato yellow vein virus
Abbreviation: PYVV1
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Crinivirus
EMBL number: AJ557128
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
6 5
17 0 16
Position Paired:
7980-7985; 8008-8013
7991-7994; 7999-8002
8003-8007; 8030-8034
Bracket view of structure:
     7980      7990      8000      8010      8020      8030
#      9|123456789|123456789|123456789|123456789|123456789|12345
$ 7979 CGGUAGAAAAGAUGGUUUAAACCACGCCUUCUACCAAGUUAGUAAAUAAAUAGGCGG=8035
% 7979 :((((((:::::((((::::))))[[[[[))))))::::::::::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00259.html