Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PYVV2

PKB-number: PKB260
Definition: A 3'-terminal pseudoknot in PYVV RNA 2
Organism: potato yellow vein virus
Abbreviation: PYVV2
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Crinivirus
EMBL number: AJ557129
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
5 4
19 1 18
Position Paired:
5284-5288; 5313-5317
5294-5297; 5304-5307
5308-5311; 5336-5339
Bracket view of structure:
           5290      5300      5310      5320      5330
#      3456789|123456789|123456789|123456789|123456789|123456789
$ 5283 AGUAGAAAAGUUGGUGCUUAGACCACGCCCUCUACCGUAAUAAUAGAUAAAUAGGCG=5339
% 5283 :(((((:::::((((::::::))))[[[[:)))))::::::::::::::::::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00260.html