Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PYVV3

PKB-number: PKB261
Definition: A 3'-terminal pseudoknot in PYVV RNA 3
Organism: potato yellow vein virus
Abbreviation: PYVV3
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Crinivirus
EMBL number: AJ508757
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
6 5
19 0 16
Position Paired:
3835-3840; 3865-3870; 3846-3850; 3855-3859
3860-3864; 3887-3891
Bracket view of structure:
          3840      3850      3860      3870      3880      3890
#      456789|123456789|123456789|123456789|123456789|123456789|12
$ 3834 CGGUAGAAAAGAUGGUUUGAAAACCACGCCUUCUACCAAUAUAGUAAAUAAAUAGGCGG=3892
% 3834 :((((((:::::(((((::::)))))[[[[[))))))::::::::::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00261.html