Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CYSDV1

PKB-number: PKB263
Definition: A 3'-terminal pseudoknot in CYSDV RNA 1
Organism: cucurbit yellow stunting disorder virus
Abbreviation: CYSDV1
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Crinivirus
EMBL number: AJ537493
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
7 4
21 1 16
Position Paired:
9066-9072; 9099-9105
9079-9083; 9088-9092
9094-9097; 9122-9125
Bracket view of structure:
         9070      9080      9090      9100      9110      9120
#      56789|123456789|123456789|123456789|123456789|123456789|123456
$ 9065 CGACACUCUAAAGAGUUCCGUGAGGAACCACCUUGAGUGUCUAGUUAUAAAUAAACUAGGUC=9126
% 9065 :(((((((::::::(((((::::))))):[[[[:)))))))::::::::::::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00263.html