Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CYSDV2

PKB-number: PKB264
Definition: A 3'-terminal pseudoknot in CYSDV RNA 2
Organism: cucurbit yellow stunting disorder virus
Abbreviation: CYSDV2
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Crinivirus
EMBL number: AJ439690
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
7 4
21 1 16
Position Paired:
7915-7921; 7948-7954
7928-7932; 7937-7941
7943-7946; 7971-7974
Bracket view of structure:
          7920      7930      7940      7950      7960      7970
#      456789|123456789|123456789|123456789|123456789|123456789|12345
$ 7914 CGACACUCUAAAGUGUUCCAAGAGGAACCACCUUGAGUGUCUAGUUAUAAAUAAACUAGGUC=7975
% 7914 :(((((((::::::(((((::::))))):[[[[:)))))))::::::::::::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00264.html