Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
LIYV1

PKB-number: PKB266
Definition: A 3'-terminal pseudoknot in LIYV RNA 1
Organism: lettuce infectious yellows virus
Abbreviation: LIYV1
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Crinivirus
EMBL number: U15440
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
7 4
6 0 15
Position Paired:
8073-8079; 8090-8096
8086-8089; 8112-8115
Bracket view of structure:
            8080      8090      8100      8110
#      23456789|123456789|123456789|123456789|12345678
$ 8072 UGUCUUCCUAAAAUCCUUGGAAGACUGUAUAUAUAGAAUAAAGGUCG=8118
% 8072 :(((((((::::::[[[[))))))):::::::::::::::]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00266.html