Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
LChV-1

PKB-number: PKB267
Definition: A 3'-terminal pseudoknot in LChV-1
Organism: little cherry virus 1
Abbreviation: LChV-1
RNA type: Viral 3 UTR
Keywords: Closteroviridae
EMBL number: X93351
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
9 5
27 0 14
Position Paired:
8267-8275; 8308-8316
8283-8290; 8295-8302
8303-8307; 8331-8335
Bracket view of structure:
        8270      8280      8290      8300      8310      8320
#      6789|123456789|123456789|123456789|123456789|123456789|
$ 8266 AAUGCAACUUUUAAAUAGUUUAUCUGUUAAGAUAAACCACCUAGGUUGCAUAUAU=8320
% 8266 :(((((((((:::::::((((((((::::))))))))[[[[[)))))))))::::

             8330
#      123456789|1234567
$ 8321 AAAAAAUAAAAGGUGCC=8337
% 8321 ::::::::::]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00267.html