Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BYV

PKB-number: PKB268
Definition: A 3'-terminal pseudoknot in BYV
Organism: beet yellows virus
Abbreviation: BYV
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Closterovirus
EMBL number: AF190581
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
7 4
3 1 11
Position Paired:
15430-15436; 15445-15451
15440-15443; 15463-15466
Bracket view of structure:
     15430     15440     15450     15460
#       9|123456789|123456789|123456789|12345678
$ 15429 CUCCUAGCGAAGUCCCGCUAGGAAGAAAAAAUAAGGGCCG=15468
% 15429 :(((((((:::[[[[:))))))):::::::::::]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00268.html