Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMWaV-2

PKB-number: PKB270
Definition: A 3'-terminal pseudoknot in PMWaV-2
Organism: Pineapple mealybug wilt associated virus - 2
Abbreviation: PMWaV-2
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Ampelovirus
EMBL number: AF283103
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
8 5
31 1 1
Position Paired:
14801-14808; 14846-14853
14823-14828; 14834-14839
14840-14844; 14855-14859
Bracket view of structure:
    14800     14810     14820     14830     14840     14850     14860
#       |123456789|123456789|123456789|123456789|123456789|123456789|1
$ 14800 CAAAGUCCUAUAAACCUCAAUAAUCCCUCGUUAGGAGGGACACGCGAGGACUUUGGCGUGCC=14861
% 14800 :((((((((::::::::::::::((((((:::::))))))[[[[[:)))))))):]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00270.html