Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
GLRaV-3

PKB-number: PKB271
Definition: A 3'-terminal pseudoknot in GLRaV-3
Organism: Grapevine leafroll-associated virus - 2
Abbreviation: GLRaV-3
RNA type: Viral 3 UTR
Keywords: Closteroviridae; Ampelovirus
EMBL number: AF037268
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1].
Stem sizes:
Loop sizes:
4 6
20 0 34
Position Paired:
17846-17849; 17876-17879
17855-17858; 17866-17869
17880-17885; 17890-17895
17870-17875; 17914-17919
Bracket view of structure:
         17850     17860     17870     17880     17890     17900
#       56789|123456789|123456789|123456789|123456789|123456789|
$ 17845 ACGCCAAAAUCCAAUUAAAGUUUGGGACCUAGGCGGGCCUCUUACGAGGCUAACUU=17900
% 17845 :((((:::::((((:::::::))))[[[[[[))))((((((::::)))))):::::

             17910
#       123456789|123456789
$ 17901 AUCGACAAUAAGUUAGGUC=17919
% 17901 :::::::::::::]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00271.html