Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SCFaV

PKB-number: PKB272
Definition: A 3'-terminal pseudoknot in SCFaV
Organism: strawberry chlorotic fleck associated virus
Abbreviation: SCFaV
RNA type: Viral 3 UTR
Keywords: Closteroviridae; closterovirus
EMBL number: DQ860839
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Tzanetakis I.E. et al. (2007). Virus Res. 124:88-94.
[2] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075.
Comment: Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1,2].
Stem sizes:
Loop sizes:
8 6
28 0 5
Position Paired:
16975-16982; 17017-17024
16988-16992; 17006-17010
16994-16997; 17002-17005
17011-17016; 17030-17035
Bracket view of structure:
          16980     16990     17000     17010     17020     17030
#       456789|123456789|123456789|123456789|123456789|123456789|123456789
$ 16974 ACUGUGAUUAUAAAAGUGGAGUACUAAAGUACCCACUACCUUUAAUCACAGACAAUAAAGGUCCAU=17039
% 16974 :((((((((:::::(((((:((((::::)))))))))[[[[[[)))))))):::::]]]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00272.html