Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IBV_PK_NS

PKB-number: PKB274
Definition: Pseudoknot at the 3' splice-site of NS gene of influenza B virus
Organism: influenza B virus, strain B/Victoria/02/1987
Abbreviation: IBV_PK_NS
RNA type: Viral others
Keywords: Orthomyxoviridae; Influenza virus
EMBL number: CY018761
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison;
References: [1] Gultyaev A.P., Heus H.A. & Olsthoorn R.C.L. (2007). Bioinformatics 23:272-276
Comment: This pseudoknot is conserved in influenza A and B viruses [1].
Stem sizes:
Loop sizes:
6 6
11 12 0
Position Paired:
699-704; 734-739
716-721; 740-745
Bracket view of structure:
      700       710       720       730       740
#     89|123456789|123456789|123456789|123456789|123456
$ 698 ACUGAUGAUCUUACAGUGGAGGAUGAAGAAGAUGGCCAUCGGAUCCUCA=746
% 698 :((((((:::::::::::[[[[[[::::::::::::))))))]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00274.html