Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Bs_glmS_P3.1

PKB-number: PKB275
Definition: The glmS ribozyme pseudoknot P3.1
Organism: Bacillus subtilis
Abbreviation: Bs_glmS_P3.1
RNA type: Ribozymes
Keywords: Bacteria; riboswitch; ribozyme
EMBL number: U21932
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison;
References: [1] Wilkinson S.R. & Been M.D. (2005). RNA 11:1788-1794.
Comment: This structure is conserved in some of the Gram-positive bacteria [1].
Stem sizes:
Loop sizes:
6 6
7 0 52
Position Paired:
139-144; 158-163
169-175; 205-211
181-187; 192-198
152-157; 216-221
Bracket view of structure:
      140       150       160       170       180       190
#     89|123456789|123456789|123456789|123456789|123456789|
$ 138 CCGGCUGAGUGUGCAGAUCACAGCCGUAAGAAUUUCUUCAAACCAAGGGGGUG=190
% 138 :((((((:::::::[[[[[[)))))):::::(((((((:::::(((((((:::

             200       210       220
#     123456789|123456789|123456789|12
$ 191 ACUCCUUGAACAAAGAGAAAUCACAUGAUCUU=222
% 191 :)))))))::::::)))))))::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00275.html