Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TEV_PK2

PKB-number: PKB278
Definition: The 5'-leader pseudoknot PK2 of TEV
Organism: tobacco etch virus
Abbreviation: TEV_PK2
RNA type: Viral 5 UTR
Keywords: Potyviridae; cap-independent translation
EMBL number: NC_001555
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Structure probing;
References: [1] Zeenko V. & Gallie D.R. (2005). J. Biol. Chem. 280:26813-26824.
Comment:
Stem sizes:
Loop sizes:
6 3
3 2 4
Position Paired:
78-83; 92-97
87-89; 102-104
Bracket view of structure:
       80        90       100
#    789|123456789|123456789|12345
$ 77 AUUUAAAUCAUUUCUUUUAAAGCAAAAGC=105
% 77 :((((((:::[[[::))))))::::]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00278.html