Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TEV_PK3

PKB-number: PKB279
Definition: The 5'-leader pseudoknot PK3 of TEV
Organism: tobacco etch virus
Abbreviation: TEV_PK3
RNA type: Viral 5 UTR
Keywords: Potyviridae; cap-independent translation
EMBL number: NC_001555
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Structure probing;
References: [1] Zeenko V. & Gallie D.R. (2005). J. Biol. Chem. 280:26813-26824.
Comment:
Stem sizes:
Loop sizes:
5 3
2 0 1
Position Paired:
106-110; 116-120
113-115; 122-124
Bracket view of structure:
         110       120
#     56789|123456789|12345
$ 105 CAAUUUUCUGAAAAUUUUCAC=125
% 105 :(((((::[[[))))):]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00279.html