Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
VMV

PKB-number: PKB280
Definition: Gag/pol ribosomal frameshift site of Visna-Maedi virus
Organism: Visna-Maedi virus
Abbreviation: VMV
RNA type: Viral Frameshift
Keywords: Retroviridae; Ribosomal frameshifting; Gag-pol
EMBL number: NC_001452
Submitted by: A. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,NMR,Sequence comparison,Structure probing
References: [1]Pennell S. et al. (2008). RNA 14:1366-1377
Stem sizes:
Loop sizes:
7 7
5 7 14
Position Paired:
1776-1782; 1802-1808
1788-1794; 1823-1829
Bracket view of structure:
           1770      1780      1790      1800      1810      1820      1830
#      3456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1763 GGGAAACAACAGGAGGGGGCCACGUGUGGUGCCGUCCGCGCCCCCUAUGUUGUAACAGAAGCACCACC=1830
% 1763 :::::::::::::(((((((:::::[[[[[[[:::::::)))))))::::::::::::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-7-3 PKB00280.HTML