Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ScYLV

PKB-number: PKB281
Definition: P1/P2 ribosomal frameshift site
Organism: sugarcane yellow leaf virus
Abbreviation: ScYLV
RNA type: Viral Frameshift
Keywords: Luteoviridae; ribosomal frameshifting
EMBL number: NC_000874
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: NMR,Sequence comparison
References: [1] Cornish P.V. et al. (2005). Proc.Natl.Acad.Sci. USA 102:12694-12699.
Stem sizes:
Loop sizes:
5 3
2 1 9
Position Paired:
1766-1770; 1777-1781
1773-1775; 1791-1793
Bracket view of structure:
           1760      1770      1780      1790
#      3456789|123456789|123456789|123456789|12345
$ 1753 GGGAAACGAGCCAAGUGGCGCCGACCACUUAAAAACACCGGAA=1795
% 1753 :::::::::::::(((((::[[[:))))):::::::::]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2008-8-14 PKB00281.HTML